pet15b (New England Biolabs)

New England Biolabs is a verified supplier

New England Biolabs manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

New England Biolabs pet15b
Pet15b, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 33344 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pet15b/T4+DNA+Ligase/pm34699194__ja1c06402_si_001-153-28-8
Average 99 stars, based on 33344 article reviews

pet15b - by Bioz Stars, 2026-09

99/100 stars

Images

Isolation:

Article Title: A regulator of amino acid catabolism controls Acinetobacter baumannii gut colonization
Article Snippet: .. The astR ORF was isolated with the primer pair JG41 and JG42, and ligated into digested pET15b (NdeI, XhoI) with HiFi DNA Assembly kit (NEB) to generate pLDP208(pET15b- astR ) which was amplified in E. coli DH5α pir116 . .. E. coli BL21 (DE3) RIL was transformed with pLDP208 and grown in terrific broth (tryptone 12 g/L, yeast extract 24 g/L, K 2 HPO 4 9.4 g/L, KH 2 PO 4 2.2 g/L, 0.8% glycerol, MilliporeSigma) with carbenicillin 75 mg/L at 37°C to an OD 600 of 0.6 before induction with 0.1 mM IPTG and incubated at 15°C at 250 rpm for 16 h. Cells were harvested by centrifugation at 4,137 x g for 10 minutes and resuspended in B-PERTM Bacterial Protein Extraction Reagent (Thermo Fisher).

Amplification:

Plasmid Preparation:

Article Title: Cold setting of gelatin–antioxidant peptides composite hydrogels using a new psychrophilic recombinant transglutaminase (rTGase)
Article Snippet: This study used a new psychrophilic transglutaminase (TGase) to catalyze the formation of protein and peptide hydrogels by forming isopeptide bonds.. The psychrophilic recombinant TGase (rTGase) was overexpressed in E. coli and purified using a Ni-Sepharose column followed by stepwise dialysis to recover the cold-active enzyme (specific activity of 1.63 U/mg).. The rTGase catalyzed the formation of cold-set hydrogels at 4 C, which were comprised of high molecular weight gelatin and antioxidant peptides.

Gel Extraction:

Article Title: Distinct regions of H. pylori’ s bactofilin CcmA regulate protein–protein interactions to control helical cell shape
Article Snippet: Truncated versions of CcmA were cloned into pET15b, a cloning vector used for expressing N-terminal 6-his tagged proteins, with the In-Fusion cloning kit (Takara). .. First, pET15b was linearized with restriction enzymes BamHI-HF (NEB) and NdeI (NEB), then gel extracted and purified using QIAquick Gel Extraction Kit (QIAGEN). .. Next, PCR products containing truncated versions of CcmA flanked by 15 nucleotides of homology to the plasmid backbone were amplified and the products were purified with the QIAquick PCR Purification Kit (QIAGEN).

Purification:

Article Title: Supporting Information Molecular Basis of Ca(II)-induced Tetramerization and Transition-metal Sequestration in Human Calprotectin
Article Snippet: .. The plasmids were digested with XbaI and XhoI (New England Biolabs) and the resulting gene fragments were gel purified and subcloned into the XbaI and XhoI sites of pET15b using T4 DNA ligase. ..

Article Title: Convergent Biochemical Pathways for Xanthine Alkaloid Production in Plants Evolved from Ancestral Enzymes with Different Catalytic Properties
Article Snippet: Linear fragments corresponding to the expected sizes were gel purified using the QIAEXII gel extraction kit (Qiagen Corp.) according to the manufacturer’s instructions. .. Purified DNA fragments were ligated into pET15b using T4 DNA ligase from New England Biolabs. ..

Generated:

Article Title: Massively parallel, computationally-guided design of a pro-enzyme
Article Snippet: .. The N-terminal, thrombin cleavable His-tag variants were generated by amplifying the entire coding region (Table S7, primers 14-15), excluding the His-tag, and inserting it using Gibson assembly into pET15b digested using NdeI and XhoI (New England Biolabs Inc.). ..

Article Title: Massively parallel, computationally guided design of a proenzyme
Article Snippet: .. The N-terminal, thrombin cleavable His-tag variants were generated by amplifying the entire coding region (Table S10, primers 14-15), excluding the His-tag, and inserting it using Gibson assembly (6) into pET15b digested using NdeI and XhoI (New England Biolabs Inc.). ..

Construct:

Article Title: Lysine 2,3-Aminomutase and a Newly Discovered Glutamate 2,3-Aminomutase Produce β-Amino Acids Involved in Salt Tolerance in Methanogenic Archaea.
Article Snippet: .. Name of construct Description Primers pET15b_MmarC70106 MmarC7_0106 (MmpKAM) cloned into pET15b using NdeI and XhoI restriction sites Fwd: 5’GCTCGCCCATATGAACGAATTA AGTGACG 3’ Rev: 5’TAATTTCTCGAGTTAGTC ATCCCTCCGTGC 3’ pET15b_MmarC71783 MmarC7_1783, the longaminomutase from M. maripaludis C7, cloned into pET15b using NEB HiFi assembly Fwd: 5’GGTGCCGCGCGGCAGCCATAT GCAAAACGACCATTTTAATTC 3’ Rev: 5’GTTAGCAGCCGGATCCTCG AGCATTAAAAATAATACCATATA GAC 3’ pET15b_MmarC71783 _trunc A truncated form of MmarC7_1783 that lacks the extended N-terminus (lacking amino acids 1- 133) cloned into pET15b using NEB HiFi assembly Fwd: 5’GGTGCCGCGCGGCAGCCATAT GGGTAGAAATTCAGCGGTTC 3’ Rev: 5’GTTAGCAGCCGGATCCTCGAGC ATTAAAAATAATACCATATAGAC 3’ pET15b_EcKAM KAM from E. coli BL21 cloned into pET15b using NEB HiFi assembly Fwd: 5’GGTGCCGCGCGGCAGCCATAT G GCGCATATTGTAACCCTA 3’ Rev: 5’CCAGCTACGCCAGCAGTAATGC TCGAGGATCCGGCTGC 3’ pET15b_CsKAM KAM from Clostridium subterminale in pET15b, synthetic gene prepared by IDT. ..

Review